Services
VDJSolver - 1.0
Analysis of human immunoglobulin VDJ recombination
The VDJsolver 1.0 server is a program that analyses human immunoglobulin VDJ recombination. The indetification of V and J genes is performed using standard sequencial alignment against databases of functional VH and JH genes from the IMGT database.
Sequences are aligned to the following model:
VH-PVH-N1-PDup-D-PDdown-N2-PJH-JH,
where Pxx designates palindromic nucleotide segments, and Nx
N nucleotides upstream or downstream of D. The optimal alignment is
obtained using maximum likelihood to select the best fit of the sequence to the model.
In the fitting all segments except VH and JH may be omitted. The model includes all
conventional germline D segments in the IMGT database (D gene list)
in normal and inverted reading direction.
For details on the model please see
the Model description.
The project is collaboration between CBS and Clinical immunology, University of Southern Denmark.
Submission
CITATIONS
For publication of results, please cite:
- Current version:
No evidence for the use of DIR, D-D fusions, chromosome 15 open reading frames or VH replacement in the peripheral repertoire was found on application of an improved algorithm, JointML, to 6329 human immunoglobulin H rearrangements.
Ohm-Laursen L, Nielsen M, Larsen SR, and Barington T.
Immunology. 119(2):265-77. 2006View the abstract
Instructions
In order to use the VDJsolver server for prediction on nucleotide sequences:
- Enter the sequence in the sequence window, or give a file name.
The sequence must be written using the one letter code: `acgt' or `ACGT'.
Other letters are ignored and treated as unknown.
Other characters, such as whitespace and numbers, will simply be ignored. - Press the "Submit sequence" button.
- A www page will return the results when the prediction is ready. Response time depends on system load.
Model description
VDJsolver was developed using Yabasic (www.yabasic.de).
The program uses the maximum likelihood
method to obtain the best fit to the following model:
VH-PH-N1-PDdown-D-PDup-N2-PJ-JH,
where Nx designates N and P palindromic nucleotides upstream or downstream of
the D gene as indicated. Any segment may be omitted except VH and JH.
VH was compared with the IGHV3-23*01 germline gene (GenBank accession
number M99660) while JH was compared with the germline JH gene with the
highest identity score from codon 114 through the splice site among all
JH-genes in the IMGT database. The D segments were compared with any
germline D segment available in the IMGT database.
P segments were defined as 2-8 nucleotide long
extensions from the VH, Dx or JH genes reverse complementary to the
corresponding germline sequence. Maximum likelihood was determined by
running through all possible combinations of segments for a given
rearrangement and finding the combination maximizing the likelihood
score. The score was defined as the product of estimated probabilities
for any event deviating from the germline sequences in question.
Probabilities for transitions and transversions in VH, Dx and JH
segments were calculated from the number of substitutions found in the
VH region from codon 1 through 100 (assuming a 5/4 ratio of transitions
to transversions). For un-mutated sequences, the estimated Taq error
rate was used. A given N nucleotide was attributed a probability equal
to its frequency in all N segments (determined by iteration of the
model on all sequences). To reduce stochastic assignment of D segments,
D segments shorter than 4 nucleotides were not accepted and D segments
with more mutations than the 95 percentile of that expected by the
assumed mutation rate and length of the D segment (Poisson
distribution) were not accepted either. A dynamic probability for
including a D segment was introduced, dependent on the length of the
joint region (codons 101 through the downstream splice site) and the
mutation rate of the VH region. The parameters were fine tuned to find
a D gene in 5% of the sequences from a set of artificial
rearrangements made by a random permutation of the bases between the VH
and JH segments of real rearrangements. D segments were generally at
least eight nucleotides long.
Format of VDJsolver output
EXAMPLE OUTPUT
VDJsolver 1.0 using the JointMLc algorithm for IgH joint composition (version 060505) Result for sequence no: 1 >seq1 Rearrangement GTGCATTACTGTGCGAAGGGGAGGCTAGAGGATCCCGGGGAGCTACTAAAACTACCAAAACAACCATACTACCACTACCACGGCATGGACGTCGGGCGCCAAGGGACCACGGTCACCGTCTCCTCACGT ..at.............aga <- V-gene: IGHV3-23*01 GTGCATTACTGTGCGAA <- VH-segment GGGGAGGCTAGAGGATCCCG <- N-addition (1) GGGAGCTACTA <- D-segment ..tatagt...........c <- D-gene: IGHD1-26*01 AAACTACCAAAACAACCA <- N-addition (2) JH-segment -> TACTACCACTACCACGGCATGGACGTCGGGCGCCAAGGGACCACGGTCACCGTCTCCTCACGT JH-gene: IGHJ6*02 -> at......t.....t....t.........t..g.............................g.. Rearrangement conserves reading frame Number of stopcodons in joint at time of rearrangement= 0 Rearrangement is productive CDR3 length (bp)= 81
References
No Evidence for the use of DIR, D-D Fusions, Chromosome 15 Open Reading Frames or VH Replacement in the Peripheral Repertoire Was Found when Applying an Improved Algorithm, JointML, to 6329 Human IgH Rearrangement.
Line Ohm-Laursen1, Morten Nielsen2, Stine R Larsen1, and Torben Barington1* Immunology., 119(2):265-77, 2006.
1Department of Clinical Immunology, Odense University Hospital, Denmark.
2Center for Biological Sequence Analysis, BioCentrum, Technical University of Denmark, Lyngby, Denmark.
*Corresponding author.
Abstract
Antibody diversity is created by imprecise joining of the V-, (D-) and J-gene segments of the heavy and light chain loci. Analysis of rearrangements is complicated by somatic hypermutations and the uncertainty of the sources of gene segments and the precise way they recombine. It has been suggested that DIR and chromosome 15 open reading frames (OR15) can replace conventional D genes, that two or inverted D genes may be used and that the repertoire can be further diversified by VH replacement. Safe conclusions require large, well-defined sequence samples and algorithms minimizing stochastic assignment of segments. Two computer programs were developed for analysis of heavy chain joints. JointHMM is a profile hidden Markow model while JointML is a maximum likelihood based method taking the lengths of the joint and the mutational status of the VH gene into account. The programs were applied to a set of 6329 clonally unrelated rearrangements. A conventional D gene was found in 80% of un-mutated sequences and 64% of mutated sequences while D gene assignment was kept below 5% in artificial (randomly permutated) rearrangements. No evidence for the use of DIR, OR15, multiple D genes or VH replacements was found while inverted D genes were used in less than 0.1% of the sequences. JointML was shown to have a higher predictive performance when it comes to D-gene assignment in mutated and un-mutated sequences than four other publicly available programs. An online version 1.0 of JointML is available at http://services.healthtech.dtu.dk/service.php?VDJsolver-1.0. The VDJsolver 1.0 implements the JointMLc method described in the article.PMID: 17005006