<h2>Output format</h2>
<hr>
<p>
<h3>DESCRIPTION</h3>
Each input sequence will be shown with the predicted translation start
site indicated, followed by a table showing the positions and the scores
of all instances of "ATG" in the sequence.
<p>
In the lines below the sequence the predicted start codon is indicated by
the letter "i" (initiation), other instances of "ATG" by the letter "N"
(non-start). The dots (".") are place holders for all the other
sequence elements.
<p>
The scores are always in [0.0, 1.0]; when greater than 0.5 they represent
a probable translation start.
<br><br><br>
<h3>EXAMPLE OUTPUT</h3>
<font size=3 face="Courier">
<b><pre>
Translation start predictions for 1 vertebrate sequence

  Name: AT2A6.1
123456789012345678901234567890123456789012345678901234567890
CACGCGTCCGAAGCAAGATGGAGTCAAGTGATCGTTCAAGTCAAGCAAAAGCTTTCGACG
AGACAAAAACCGGCGTGAAAGGGCTTGTGGCTTCGGGAATCAAAGAGATTCCAGCCATGT
TCCATACACCTCCGGATACTCTAACAAGCCTGAAACAAACAGCACCA
.................i..........................................
........................................................N...
...............................................

   Pos    Score     Pred
------------------------
    18    0.821     Yes
   117    0.034     -

</pre>
</b></font>

</p>