DTU Health Tech
Department of Health Technology
This link is for the general contact of the DTU Health Tech institute.
If you need help with the bioinformatics programs, see the "Getting Help" section below the program.
A tool for analysing DNA barcode sequencing data.
Andrea M. Marquard and Aron C. Eklund
>Oligo_A1 CGAGGGCAATGGTTAACTGACACGT >Oligo_A2 CAGAAAGCAGTCTCGTCGGTTCGAANote that Barracoda also works for barcode designs that user other lengths than 25.
>Oligo_B1 GCCTGTAGTCCCACGCGATCTAACA >Oligo_B2 CAACCATTGATTGGGGACAACTGGGNote that Barracoda also works for barcode designs that user other lengths than 25.
<key> <tab> <sample name> <tab> <experiment>Example:
A-Key_2OS_F1_01 sampleA 1 A-Key_2OS_F1_02 sampleB 1 A-Key_2OS_F1_03 sampleX 2 A-Key_2OS_F1_04 sampleY 2 A-Key_2OS_F1_05 input 1 A-Key_2OS_F1_06 input 1 A-Key_2OS_F1_07 input 2 A-Key_2OS_F1_08 input 2
Barcode HLA allele Peptide Sequence A7B1 HLA-A0201 707-AP RVAALARDAP A7B2 HLA-A0201 ATIC (AICRT) RLDFNLIRV A7B3 HLA-A0201 ATIC (AICRT) MVYDLYKTL
At any time during the wait you may enter your e-mail address and simply leave the window. Your job will continue; you will be notified by e-mail when it has terminated. The e-mail message will contain the URL under which the results are stored; they will remain on the server for 24 hours for you to collect them.
If you need help regarding technical issues (e.g. errors or missing results) contact Technical Support. Please include the name of the service and version (e.g. NetPhos-4.0). If the error occurs after the job has started running, please include the JOB ID (the long code that you see while the job is running).
If you have scientific questions (e.g. how the method works or how to interpret results), contact Correspondence.
Correspondence:
Technical Support: