DTU Health Tech

Department of Health Technology

Barracoda - 1.0

Analysing DNA barcode sequencing data


A tool for analysing DNA barcode sequencing data.

Andrea M. Marquard and Aron C. Eklund

Submission


Sequencing data

Submit FASTA/FASTQ file:   

Barcode information

For each tag within the barcode, either submit a FASTA file of expected sequences, or paste the sequence if there is only one, or type the expected base pair length if the sequence is unknown.
Orientation: Sequences should be oriented according to the orientation of the individual A- and B-oligos before annealing. Ie., B-sequences should be the reverse complement of what is expected in the sequencing reads.

Sample identification tag     (select FASTA file)
Forward primer A (paste sequence)
N sequence (type length of tag)
Epitope tag A (select FASTA file)
Annealing region (paste sequence)
Epitope tag B (select FASTA file)
N sequence (type length of tag)
Forward primer B (paste sequence)

Sample identification

Upload a tab-delimited file of paired sequence IDs (1st column) and sample names (2nd column). The file should contain no headers.
The sequence IDs should be the same as those found in the Sample identification tag FASTA file uploaded above.
Leave sample name blank for unused sequence tags, and make sure to use identical names for replicates.

Sample identification table   

Barcode annotations

Upload a file with annotations for the barcodes.

Barcode annotations   

Barcode plate setup (optional)

Upload an excel file with the experimental plate setup of the barcodes. Include as many plates as possible (also if you didn't use them), to make sure you detect any cross-plate contamination.

Barcode plate setups   


Instructions


1. Sequencing data

Upload a FASTQ (or FASTA) file with the raw sequencing reads.

2. Barcode information

  • Sample identification tag:
    Upload a FASTA file with the sequences of the sample identification tags. The names of each sequence should correspond to the keys in the 3. Sample identification table.

  • Forward primer A:
    Paste the sequence of the forward primer from Oligo-A.

  • N sequence:
    Give an integer specifying the length of the first UMI (unique molecular identifier).

  • Epitope tag A:
    Upload a FASTA file with sequences of the 25mer oligonucleotide sequence from Oligo A.
    The names of the FASTA entries must not include any spaces, and they must include "_Axx" at the end, where "xx" is an id number.
    Example:
    	>Oligo_A1
    	CGAGGGCAATGGTTAACTGACACGT
    	>Oligo_A2
    	CAGAAAGCAGTCTCGTCGGTTCGAA
    	
    Note that Barracoda also works for barcode designs that user other lengths than 25.

  • Annealing region:
    Paste the sequence of the annealing region.

  • Epitope tag B:
    Upload a FASTA file with sequences of the 25mer oligonucleotide sequence from Oligo B.
    The sequences should be from reverse strand and orientation compared to the Oligo A sequences.
    The names of the FASTA entries must not include any spaces, and they must include "_Byy" at the end, where "yy" is an id number.
    Example:
    	>Oligo_B1
    	GCCTGTAGTCCCACGCGATCTAACA
    	>Oligo_B2
    	CAACCATTGATTGGGGACAACTGGG
    	
    Note that Barracoda also works for barcode designs that user other lengths than 25.

  • N sequence:
    Give an integer specifying the length of the second UMI (unique molecular identifier).

  • Forward primer B:
    Paste the sequence of the reverse primer from Oligo-B. The sequence should be from reverse strand and orientation compared to the Primer A sequence.

3. Sample identification

Upload a tab-delimited file (with no headers), where each row is of the format:
	<key> <tab> <sample name> <tab> <experiment>
Example:
	A-Key_2OS_F1_01	sampleA	1
	A-Key_2OS_F1_02	sampleB	1
	A-Key_2OS_F1_03	sampleX	2
	A-Key_2OS_F1_04	sampleY	2
	A-Key_2OS_F1_05	input	1
	A-Key_2OS_F1_06	input	1
	A-Key_2OS_F1_07	input	2
	A-Key_2OS_F1_08	input	2
  • Importantly, key should match the sequence names in the FASTA file uploaded in the field sample identification tag.
  • Equally important, the sample name field should be "input" (all non-capital letters) for those samples that are used for controls.
  • The sample name field will be used to annotate results and figures.
  • The experiment field is used to denote that the data should be treated as multiple experiments. The samples will be analysed in the groups defined by experiment. In the above example there are two experiments: sample A and B will be analysed together with the two first input samples. Sample X and Y will be analysed together with the two last input samples.
    If all samples are to be analysed as one experiment, this field should simply contain the same value in all the rows (eg. "1").

4. Barcode annotations

Upload a tab-delimited file with user-specified annotations for the DNA barcodes. The file should have headers, but there are no specific requirements for the headers.
Example:
	Barcode	HLA allele	Peptide	Sequence
	A7B1	HLA-A0201	707-AP	RVAALARDAP
	A7B2	HLA-A0201	ATIC (AICRT)	RLDFNLIRV
	A7B3	HLA-A0201	ATIC (AICRT)	MVYDLYKTL

5. Barcode plate setups (optional)

Optionally, upload an excel file that describes how the DNA barcodes were layed out on 384-well plates in the experimental setup. This will be used to make figures of your results, where the values (read counts, log fold change, p-values) are layed out on a heatmap-type plot to mimic the 384-well plate. This will hopefully aid in detecting experimental errors and biases, such as spill-over between wells, or mix-up of barcodes on the plates.
Example of excel sheet:



5. Submit the job

Click on the "Submit" button. The status of your job (either 'queued' or 'running') will be displayed and constantly updated until it terminates and the server output appears in the browser window.

At any time during the wait you may enter your e-mail address and simply leave the window. Your job will continue; you will be notified by e-mail when it has terminated. The e-mail message will contain the URL under which the results are stored; they will remain on the server for 24 hours for you to collect them.



GETTING HELP

If you need help regarding technical issues (e.g. errors or missing results) contact Technical Support. Please include the name of the service and version (e.g. NetPhos-4.0). If the error occurs after the job has started running, please include the JOB ID (the long code that you see while the job is running).

If you have scientific questions (e.g. how the method works or how to interpret results), contact Correspondence.

Correspondence: Technical Support: